Home | Genome | Blast / Blat | WormMart | Batch Sequences | Markers | Genetic Maps | Submit | Searches | Site Map |
BLAST/BLAT RESULTS |
||
|
![]()
BLASTN 2.2.17 [Aug-26-2007]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= F01_C53F1_11.ab1 ABIX Testing -- no comment (947 letters) Database: c_elegans nucleotide release [WS195] 7 sequences; 100,281,427 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value II 159 1e-37 ![]() >II Length = 15279324 ![]() Score = 159 bits (80), Expect = 1e-37 Identities = 80/80 (100%) Strand = Plus / Minus Query: 72 ttgccattgccctcacctcttgttgaatccatatgtgatgagcggagggaggttgtgagt 131 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 10547829 ttgccattgccctcacctcttgttgaatccatatgtgatgagcggagggaggttgtgagt 10547770 Query: 132 aaaatggatgtgggaagcga 151 |||||||||||||||||||| Sbjct: 10547769 aaaatggatgtgggaagcga 10547750 |
|