BLAST/BLAT RESULTS |
||
|
|
BLASTN 2.2.17 [Aug-26-2007]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= C01_C7B2_05.ab1 ABIX Testing -- no comment (923 letters) Database: c_elegans nucleotide release [WS195] 7 sequences; 100,281,427 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value V 70 8e-11  [Alignment][Genome View]III 54 5e-06 [Alignment][Genome View]II 54 5e-06 [Alignment][Genome View]IV 52 2e-05 [Alignment][Genome View]I 46 0.001 [Alignment][Genome View]>V Length = 20919569 [Genome View]Score = 69.9 bits (35), Expect = 8e-11 Identities = 40/42 (95%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggcaaa 213 |||| ||| ||||||||||||||||||||||||||||||||| Sbjct: 5112454 aaaaattgtcgtgtcgagacctgttaccgtattgttggcaaa 5112495 Score = 54.0 bits (27), Expect = 5e-06 Identities = 29/30 (96%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgt 201 |||||||| ||||||||||||||||||||| Sbjct: 5280446 aaaatttgtcgtgtcgagacctgttaccgt 5280475 Score = 52.0 bits (26), Expect = 2e-05 Identities = 31/33 (93%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||||| ||||||||| Sbjct: 4587058 aaaatttgtcgtgtcgagacctggtaccgtatt 4587026 Score = 46.1 bits (23), Expect = 0.001 Identities = 34/38 (89%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttgg 209 |||| ||| |||||||||||||| ||||||||| |||| Sbjct: 4583642 aaaaattgtcgtgtcgagacctgctaccgtatttttgg 4583679 Score = 44.1 bits (22), Expect = 0.005 Identities = 28/30 (93%) Strand = Plus / Minus Query: 181 cgtgtcgagacctgttaccgtattgttggc 210 |||||||||||| ||||||||||| ||||| Sbjct: 2055245 cgtgtcgagaccggttaccgtatttttggc 2055216 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||| | ||||||||| Sbjct: 2130327 aaaatttgtcgtgtcgagaccgggtaccgtatt 2130295 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||| ||| ||||||||||||||| Sbjct: 3038782 aaaatttgtcgtgacgaaacctgttaccgtatt 3038750 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||| | ||||||||| Sbjct: 3192668 aaaatttgtcgtgtcgagaccagataccgtatt 3192636 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||| | ||||||||| Sbjct: 3206390 aaaatttgtcgtgtcgagaccagataccgtatt 3206422 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||| | ||||||||| Sbjct: 4759632 aaaatttgtcgtgtcgagaccgggtaccgtatt 4759600 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||| | ||||||||| Sbjct: 12050577 aaaatttgtcgtgtcgagaccgggtaccgtatt 12050545 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||| | ||||||||| Sbjct: 14641493 aaaatttgtcgtgtcgagaccgggtaccgtatt 14641461 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||| ||||||| ||||||||||| Sbjct: 14986880 aaaatttgtcgtgacgagaccggttaccgtatt 14986912 Score = 42.1 bits (21), Expect = 0.019 Identities = 32/36 (88%) Strand = Plus / Minus Query: 174 aatttgncgtgtcgagacctgttaccgtattgttgg 209 |||||| |||||||||||| || |||||||| |||| Sbjct: 155647 aatttgtcgtgtcgagaccggtaaccgtatttttgg 155612 Score = 42.1 bits (21), Expect = 0.019 Identities = 32/36 (88%) Strand = Plus / Plus Query: 175 atttgncgtgtcgagacctgttaccgtattgttggc 210 ||||| |||||||||||| | ||||||||| ||||| Sbjct: 155877 atttgtcgtgtcgagaccgggtaccgtatttttggc 155912 Score = 42.1 bits (21), Expect = 0.019 Identities = 26/28 (92%) Strand = Plus / Plus Query: 177 ttgncgtgtcgagacctgttaccgtatt 204 ||| |||||||||||||| ||||||||| Sbjct: 4736948 ttgccgtgtcgagacctggtaccgtatt 4736975 Score = 42.1 bits (21), Expect = 0.019 Identities = 26/28 (92%) Strand = Plus / Minus Query: 176 tttgncgtgtcgagacctgttaccgtat 203 |||| |||||||||||| |||||||||| Sbjct: 8616373 tttgtcgtgtcgagacccgttaccgtat 8616346 Score = 40.1 bits (20), Expect = 0.075 Identities = 22/23 (95%) Strand = Plus / Minus Query: 170 acaaaatttgncgtgtcgagacc 192 |||||||||| |||||||||||| Sbjct: 1019624 acaaaatttgtcgtgtcgagacc 1019602 Score = 40.1 bits (20), Expect = 0.075 Identities = 31/35 (88%) Strand = Plus / Plus Query: 170 acaaaatttgncgtgtcgagacctgttaccgtatt 204 |||||| ||| |||||||||||| | ||||||||| Sbjct: 2055669 acaaaaattgtcgtgtcgagaccgggtaccgtatt 2055703 Score = 40.1 bits (20), Expect = 0.075 Identities = 34/39 (87%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggc 210 |||||||| ||||||||||| | ||||||||| ||||| Sbjct: 4091378 aaaatttgttgtgtcgagaccgggtaccgtatttttggc 4091416 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Plus Query: 174 aatttgncgtgtcgagacctgttaccgtatt 204 |||||| |||||||||||| | ||||||||| Sbjct: 4446951 aatttgtcgtgtcgagaccagataccgtatt 4446981 Score = 40.1 bits (20), Expect = 0.075 Identities = 22/23 (95%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctg 194 |||||||| |||||||||||||| Sbjct: 4693706 aaaatttgtcgtgtcgagacctg 4693684 Score = 40.1 bits (20), Expect = 0.075 Identities = 34/39 (87%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggc 210 |||| ||| |||||||||||| | ||||||||| ||||| Sbjct: 4736724 aaaaattgtcgtgtcgagaccgggtaccgtatttttggc 4736686 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Plus Query: 174 aatttgncgtgtcgagacctgttaccgtatt 204 |||||| |||||||||||| ||||| ||||| Sbjct: 15548313 aatttgtcgtgtcgagaccggttactgtatt 15548343 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgta 202 |||||||| |||||||||||| | ||||||| Sbjct: 16498856 aaaatttgtcgtgtcgagaccaggtaccgta 16498886 Score = 38.2 bits (19), Expect = 0.30 Identities = 21/22 (95%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacct 193 |||||||| ||||||||||||| Sbjct: 1019162 aaaatttgccgtgtcgagacct 1019141 Score = 38.2 bits (19), Expect = 0.30 Identities = 21/22 (95%) Strand = Plus / Plus Query: 173 aaatttgncgtgtcgagacctg 194 ||||||| |||||||||||||| Sbjct: 1019852 aaatttgtcgtgtcgagacctg 1019873 Score = 38.2 bits (19), Expect = 0.30 Identities = 27/30 (90%) Strand = Plus / Minus Query: 173 aaatttgncgtgtcgagacctgttaccgta 202 ||||||| |||||||||||| | ||||||| Sbjct: 1371445 aaatttgtcgtgtcgagaccgggtaccgta 1371416 Score = 38.2 bits (19), Expect = 0.30 Identities = 25/27 (92%) Strand = Plus / Plus Query: 181 cgtgtcgagacctgttaccgtattgtt 207 |||||||||||| | |||||||||||| Sbjct: 4831347 cgtgtcgagaccagataccgtattgtt 4831373 Score = 38.2 bits (19), Expect = 0.30 Identities = 28/31 (90%) Strand = Plus / Plus Query: 181 cgtgtcgagacctgttaccgtattgttggca 211 |||||||||||| | ||||||||| |||||| Sbjct: 5225595 cgtgtcgagaccgggtaccgtatttttggca 5225625 Score = 38.2 bits (19), Expect = 0.30 Identities = 22/23 (95%) Strand = Plus / Plus Query: 182 gtgtcgagacctgttaccgtatt 204 ||||||||||||| ||||||||| Sbjct: 12490707 gtgtcgagacctggtaccgtatt 12490729 Score = 38.2 bits (19), Expect = 0.30 Identities = 30/34 (88%) Strand = Plus / Plus Query: 171 caaaatttgncgtgtcgagacctgttaccgtatt 204 |||||| || |||||||||||| | ||||||||| Sbjct: 16500315 caaaatatgccgtgtcgagaccgggtaccgtatt 16500348 >III Length = 13783681 [Genome View]Score = 54.0 bits (27), Expect = 5e-06 Identities = 32/34 (94%) Strand = Plus / Plus Query: 169 gacaaaatttgncgtgtcgagacctgttaccgta 202 ||||||||||| |||||||||||||| ||||||| Sbjct: 3494106 gacaaaatttgtcgtgtcgagacctgctaccgta 3494139 Score = 46.1 bits (23), Expect = 0.001 Identities = 37/42 (88%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggcaaa 213 |||| ||| |||||||||||| | ||||||||| |||||||| Sbjct: 3391562 aaaaattgtcgtgtcgagaccagataccgtatttttggcaaa 3391603 Score = 46.1 bits (23), Expect = 0.001 Identities = 31/34 (91%) Strand = Plus / Plus Query: 171 caaaatttgncgtgtcgagacctgttaccgtatt 204 ||||||||| |||||||||||| | ||||||||| Sbjct: 10709267 caaaatttgtcgtgtcgagaccaggtaccgtatt 10709300 Score = 44.1 bits (22), Expect = 0.005 Identities = 27/29 (93%) Strand = Plus / Minus Query: 176 tttgncgtgtcgagacctgttaccgtatt 204 |||| |||||||||||| ||||||||||| Sbjct: 4350262 tttgtcgtgtcgagaccggttaccgtatt 4350234 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||| | ||||||||| Sbjct: 5237597 aaaatttgtcgtgtcgagaccgggtaccgtatt 5237629 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||| | ||||||||| Sbjct: 7146854 aaaatttgtcgtgtcgagaccgggtaccgtatt 7146822 Score = 44.1 bits (22), Expect = 0.005 Identities = 27/29 (93%) Strand = Plus / Plus Query: 177 ttgncgtgtcgagacctgttaccgtattg 205 ||| |||||||||||| |||||||||||| Sbjct: 8383323 ttgccgtgtcgagaccagttaccgtattg 8383351 Score = 44.1 bits (22), Expect = 0.005 Identities = 24/25 (96%) Strand = Plus / Plus Query: 170 acaaaatttgncgtgtcgagacctg 194 |||||||||| |||||||||||||| Sbjct: 8937265 acaaaatttgtcgtgtcgagacctg 8937289 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||| | ||||||||| Sbjct: 10628581 aaaatttgtcgtgtcgagaccgggtaccgtatt 10628549 Score = 44.1 bits (22), Expect = 0.005 Identities = 27/29 (93%) Strand = Plus / Plus Query: 174 aatttgncgtgtcgagacctgttaccgta 202 |||||| |||||||||||||| ||||||| Sbjct: 13497711 aatttgccgtgtcgagacctgataccgta 13497739 Score = 42.1 bits (21), Expect = 0.019 Identities = 29/32 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtat 203 |||||||| |||||||||||| ||| |||||| Sbjct: 3657178 aaaatttgtcgtgtcgagaccggttgccgtat 3657209 Score = 42.1 bits (21), Expect = 0.019 Identities = 29/32 (90%) Strand = Plus / Minus Query: 173 aaatttgncgtgtcgagacctgttaccgtatt 204 ||||||| |||||||||||| | ||||||||| Sbjct: 7205982 aaatttgccgtgtcgagaccgggtaccgtatt 7205951 Score = 42.1 bits (21), Expect = 0.019 Identities = 27/29 (93%) Strand = Plus / Minus Query: 181 cgtgtcgagacctgttaccgtattgttgg 209 |||||||||||| ||||||||||| |||| Sbjct: 7991073 cgtgtcgagaccggttaccgtatttttgg 7991045 Score = 42.1 bits (21), Expect = 0.019 Identities = 26/28 (92%) Strand = Plus / Minus Query: 177 ttgncgtgtcgagacctgttaccgtatt 204 ||| |||||||||||||| ||||||||| Sbjct: 8914372 ttgtcgtgtcgagacctgataccgtatt 8914345 Score = 42.1 bits (21), Expect = 0.019 Identities = 29/32 (90%) Strand = Plus / Plus Query: 173 aaatttgncgtgtcgagacctgttaccgtatt 204 |||| || |||||||||||||| ||||||||| Sbjct: 9386778 aaatatgtcgtgtcgagacctggtaccgtatt 9386809 Score = 42.1 bits (21), Expect = 0.019 Identities = 38/44 (86%) Strand = Plus / Plus Query: 170 acaaaatttgncgtgtcgagacctgttaccgtattgttggcaaa 213 |||||| ||| |||||||||||| || |||||||| || ||||| Sbjct: 10315410 acaaaaattgtcgtgtcgagacccgtcaccgtatttttcgcaaa 10315453 Score = 42.1 bits (21), Expect = 0.019 Identities = 29/32 (90%) Strand = Plus / Plus Query: 173 aaatttgncgtgtcgagacctgttaccgtatt 204 ||||||| |||||||||||| | ||||||||| Sbjct: 13174015 aaatttgtcgtgtcgagaccgggtaccgtatt 13174046 Score = 42.1 bits (21), Expect = 0.019 Identities = 26/28 (92%) Strand = Plus / Minus Query: 177 ttgncgtgtcgagacctgttaccgtatt 204 ||| |||||||||||| ||||||||||| Sbjct: 13348363 ttgtcgtgtcgagaccggttaccgtatt 13348336 Score = 40.1 bits (20), Expect = 0.075 Identities = 23/24 (95%) Strand = Plus / Minus Query: 185 tcgagacctgttaccgtattgttg 208 |||||||||| ||||||||||||| Sbjct: 3727289 tcgagacctgataccgtattgttg 3727266 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgta 202 |||||||| |||||||||||| | ||||||| Sbjct: 5945516 aaaatttgtcgtgtcgagaccgggtaccgta 5945486 Score = 40.1 bits (20), Expect = 0.075 Identities = 34/39 (87%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggc 210 |||||||| || ||||||||||| ||||| ||| ||||| Sbjct: 8914508 aaaatttgtcgcgtcgagacctggtaccgcatttttggc 8914546 Score = 40.1 bits (20), Expect = 0.075 Identities = 34/39 (87%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggc 210 ||||| || |||||||||||| | ||||||||| ||||| Sbjct: 9527368 aaaatatgtcgtgtcgagaccagataccgtatttttggc 9527406 Score = 40.1 bits (20), Expect = 0.075 Identities = 34/39 (87%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggc 210 |||| ||| |||||||||||| | ||||||||| ||||| Sbjct: 9611550 aaaacttgtcgtgtcgagaccgggtaccgtatttttggc 9611588 Score = 40.1 bits (20), Expect = 0.075 Identities = 23/24 (95%) Strand = Plus / Plus Query: 181 cgtgtcgagacctgttaccgtatt 204 |||||||||||||| ||||||||| Sbjct: 10874969 cgtgtcgagacctggtaccgtatt 10874992 Score = 40.1 bits (20), Expect = 0.075 Identities = 31/35 (88%) Strand = Plus / Minus Query: 176 tttgncgtgtcgagacctgttaccgtattgttggc 210 |||| |||||||||||| | ||||||||| ||||| Sbjct: 11041600 tttgtcgtgtcgagaccaggtaccgtatttttggc 11041566 Score = 40.1 bits (20), Expect = 0.075 Identities = 23/24 (95%) Strand = Plus / Plus Query: 181 cgtgtcgagacctgttaccgtatt 204 |||||||||||||| ||||||||| Sbjct: 13561534 cgtgtcgagacctgataccgtatt 13561557 Score = 38.2 bits (19), Expect = 0.30 Identities = 21/22 (95%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacct 193 |||||||| ||||||||||||| Sbjct: 3393949 aaaatttgtcgtgtcgagacct 3393970 Score = 38.2 bits (19), Expect = 0.30 Identities = 33/38 (86%) Strand = Plus / Plus Query: 173 aaatttgncgtgtcgagacctgttaccgtattgttggc 210 ||||||| |||||||||||| | |||||||| ||||| Sbjct: 6389661 aaatttgtcgtgtcgagaccgggcaccgtatttttggc 6389698 Score = 38.2 bits (19), Expect = 0.30 Identities = 30/34 (88%) Strand = Plus / Minus Query: 170 acaaaatttgncgtgtcgagacctgttaccgtat 203 ||||| |||| |||||||||||| | |||||||| Sbjct: 7226242 acaaagtttgtcgtgtcgagaccggataccgtat 7226209 Score = 38.2 bits (19), Expect = 0.30 Identities = 25/27 (92%) Strand = Plus / Plus Query: 181 cgtgtcgagacctgttaccgtattgtt 207 |||||||||||| | |||||||||||| Sbjct: 7284960 cgtgtcgagaccaggtaccgtattgtt 7284986 Score = 38.2 bits (19), Expect = 0.30 Identities = 27/30 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgt 201 |||||||| |||||||||||| | |||||| Sbjct: 8381576 aaaatttgtcgtgtcgagaccgggtaccgt 8381605 Score = 38.2 bits (19), Expect = 0.30 Identities = 27/30 (90%) Strand = Plus / Minus Query: 175 atttgncgtgtcgagacctgttaccgtatt 204 ||||| |||||||||||| | ||||||||| Sbjct: 8385714 atttgtcgtgtcgagaccgggtaccgtatt 8385685 Score = 38.2 bits (19), Expect = 0.30 Identities = 25/27 (92%) Strand = Plus / Minus Query: 183 tgtcgagacctgttaccgtattgttgg 209 |||||||||||| |||||||| ||||| Sbjct: 8401130 tgtcgagacctggtaccgtatggttgg 8401104 Score = 38.2 bits (19), Expect = 0.30 Identities = 27/30 (90%) Strand = Plus / Minus Query: 175 atttgncgtgtcgagacctgttaccgtatt 204 ||||| | |||||||||||| ||||||||| Sbjct: 9838771 atttgtcttgtcgagacctggtaccgtatt 9838742 Score = 38.2 bits (19), Expect = 0.30 Identities = 27/30 (90%) Strand = Plus / Plus Query: 175 atttgncgtgtcgagacctgttaccgtatt 204 ||||| |||||||||||| |||||| |||| Sbjct: 10124598 atttgtcgtgtcgagaccggttaccatatt 10124627 Score = 38.2 bits (19), Expect = 0.30 Identities = 28/31 (90%) Strand = Plus / Minus Query: 181 cgtgtcgagacctgttaccgtattgttggca 211 ||||||||||| ||||||||||| |||||| Sbjct: 10247181 cgtgtcgagactcgttaccgtatttttggca 10247151 Score = 38.2 bits (19), Expect = 0.30 Identities = 21/22 (95%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacct 193 |||||||| ||||||||||||| Sbjct: 11010981 aaaatttgccgtgtcgagacct 11011002 >II Length = 15279324 [Genome View]Score = 54.0 bits (27), Expect = 5e-06 Identities = 35/38 (92%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttgg 209 |||||||| ||||||||||||||||||| |||| |||| Sbjct: 13695891 aaaatttgtcgtgtcgagacctgttaccatatttttgg 13695928 Score = 52.0 bits (26), Expect = 2e-05 Identities = 31/33 (93%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| ||||||||||||||||||| |||| Sbjct: 13696768 aaaatttgtcgtgtcgagacctgttaccatatt 13696736 Score = 50.1 bits (25), Expect = 8e-05 Identities = 33/36 (91%) Strand = Plus / Plus Query: 171 caaaatttgncgtgtcgagacctgttaccgtattgt 206 ||||| ||| |||||||||||||| ||||||||||| Sbjct: 13041137 caaaaattgacgtgtcgagacctggtaccgtattgt 13041172 Score = 48.1 bits (24), Expect = 3e-04 Identities = 35/39 (89%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggc 210 |||||||| |||||||||||| | ||||||||| ||||| Sbjct: 6253757 aaaatttgtcgtgtcgagaccggataccgtatttttggc 6253719 Score = 46.1 bits (23), Expect = 0.001 Identities = 34/38 (89%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttgg 209 |||||||| |||||||||||| ||||| ||||| |||| Sbjct: 4755922 aaaatttgtcgtgtcgagaccagttacggtattattgg 4755885 Score = 44.1 bits (22), Expect = 0.005 Identities = 36/41 (87%) Strand = Plus / Minus Query: 170 acaaaatttgncgtgtcgagacctgttaccgtattgttggc 210 |||||| ||| |||||||||||| | ||||||||| ||||| Sbjct: 5513178 acaaaaattgtcgtgtcgagaccgggtaccgtatttttggc 5513138 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||| ||| |||||||||||||| ||||||||| Sbjct: 5678517 aaaaattgtcgtgtcgagacctggtaccgtatt 5678485 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||| | ||||||||| Sbjct: 6852951 aaaatttgtcgtgtcgagaccggataccgtatt 6852983 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||| ||| |||||||||||||| ||||||||| Sbjct: 10788941 aaaaattgtcgtgtcgagacctgataccgtatt 10788973 Score = 42.1 bits (21), Expect = 0.019 Identities = 32/36 (88%) Strand = Plus / Minus Query: 176 tttgncgtgtcgagacctgttaccgtattgttggca 211 |||| |||||| ||||| ||||||||||| |||||| Sbjct: 5375477 tttgtcgtgtcaagaccagttaccgtatttttggca 5375442 Score = 40.1 bits (20), Expect = 0.075 Identities = 23/24 (95%) Strand = Plus / Minus Query: 181 cgtgtcgagacctgttaccgtatt 204 |||||||||||||| ||||||||| Sbjct: 4377587 cgtgtcgagacctggtaccgtatt 4377564 Score = 40.1 bits (20), Expect = 0.075 Identities = 34/39 (87%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggc 210 |||||||| |||||||||||| |||| ||||| ||||| Sbjct: 4790796 aaaatttgtcgtgtcgagaccatttacggtattattggc 4790834 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgta 202 |||||||| |||||||||||| | ||||||| Sbjct: 5711794 aaaatttgtcgtgtcgagaccaggtaccgta 5711824 Score = 40.1 bits (20), Expect = 0.075 Identities = 31/35 (88%) Strand = Plus / Plus Query: 170 acaaaatttgncgtgtcgagacctgttaccgtatt 204 ||||||| || |||||||||||| | ||||||||| Sbjct: 9350055 acaaaatatgtcgtgtcgagaccggataccgtatt 9350089 Score = 40.1 bits (20), Expect = 0.075 Identities = 34/39 (87%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggc 210 |||||||| |||||||||||| | |||||| || ||||| Sbjct: 10609047 aaaatttgtcgtgtcgagaccgggtaccgtgtttttggc 10609009 Score = 40.1 bits (20), Expect = 0.075 Identities = 31/35 (88%) Strand = Plus / Minus Query: 170 acaaaatttgncgtgtcgagacctgttaccgtatt 204 |||||| ||| |||||||||||| | ||||||||| Sbjct: 11234219 acaaaaattgtcgtgtcgagaccggataccgtatt 11234185 Score = 40.1 bits (20), Expect = 0.075 Identities = 23/24 (95%) Strand = Plus / Minus Query: 181 cgtgtcgagacctgttaccgtatt 204 |||||||||||||| ||||||||| Sbjct: 11500699 cgtgtcgagacctggtaccgtatt 11500676 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Plus Query: 174 aatttgncgtgtcgagacctgttaccgtatt 204 |||||| |||||||||||| | ||||||||| Sbjct: 11575509 aatttgtcgtgtcgagaccagctaccgtatt 11575539 Score = 40.1 bits (20), Expect = 0.075 Identities = 34/39 (87%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggc 210 |||| ||| |||||||||||| | ||||||||| ||||| Sbjct: 12684799 aaaaattgtcgtgtcgagacccggtaccgtatttttggc 12684837 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Minus Query: 174 aatttgncgtgtcgagacctgttaccgtatt 204 |||||| || ||||||||||| ||||||||| Sbjct: 12786037 aatttgtcgcgtcgagacctggtaccgtatt 12786007 Score = 40.1 bits (20), Expect = 0.075 Identities = 22/23 (95%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctg 194 |||||||| |||||||||||||| Sbjct: 14485257 aaaatttgtcgtgtcgagacctg 14485279 Score = 40.1 bits (20), Expect = 0.075 Identities = 22/23 (95%) Strand = Plus / Minus Query: 170 acaaaatttgncgtgtcgagacc 192 |||||||||| |||||||||||| Sbjct: 15243916 acaaaatttgtcgtgtcgagacc 15243894 Score = 40.1 bits (20), Expect = 0.075 Identities = 22/23 (95%) Strand = Plus / Plus Query: 170 acaaaatttgncgtgtcgagacc 192 |||||||||| |||||||||||| Sbjct: 15244124 acaaaatttgtcgtgtcgagacc 15244146 Score = 38.2 bits (19), Expect = 0.30 Identities = 22/23 (95%) Strand = Plus / Minus Query: 181 cgtgtcgagacctgttaccgtat 203 |||||||||||||| |||||||| Sbjct: 5476054 cgtgtcgagacctggtaccgtat 5476032 Score = 38.2 bits (19), Expect = 0.30 Identities = 30/34 (88%) Strand = Plus / Plus Query: 176 tttgncgtgtcgagacctgttaccgtattgttgg 209 |||| |||||||||||| | ||||||||| |||| Sbjct: 6721362 tttgtcgtgtcgagaccggataccgtattattgg 6721395 Score = 38.2 bits (19), Expect = 0.30 Identities = 30/34 (88%) Strand = Plus / Plus Query: 171 caaaatttgncgtgtcgagacctgttaccgtatt 204 ||||| ||| |||||||||||| | ||||||||| Sbjct: 7191782 caaaaattgtcgtgtcgagaccgggtaccgtatt 7191815 Score = 38.2 bits (19), Expect = 0.30 Identities = 21/22 (95%) Strand = Plus / Plus Query: 171 caaaatttgncgtgtcgagacc 192 ||||||||| |||||||||||| Sbjct: 13455681 caaaatttgtcgtgtcgagacc 13455702 >IV Length = 17493784 [Genome View]Score = 52.0 bits (26), Expect = 2e-05 Identities = 31/33 (93%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||||| ||||||||| Sbjct: 1973196 aaaatttgtcgtgtcgagacctggtaccgtatt 1973164 Score = 50.1 bits (25), Expect = 8e-05 Identities = 33/36 (91%) Strand = Plus / Minus Query: 171 caaaatttgncgtgtcgagacctgttaccgtattgt 206 ||||| ||| |||||||||||||| ||||||||||| Sbjct: 5488911 caaaaattgtcgtgtcgagacctggtaccgtattgt 5488876 Score = 48.1 bits (24), Expect = 3e-04 Identities = 35/39 (89%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggc 210 |||||||| |||||||||||| | ||||||||| ||||| Sbjct: 7550421 aaaatttgtcgtgtcgagaccgggtaccgtatttttggc 7550459 Score = 46.1 bits (23), Expect = 0.001 Identities = 34/38 (89%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttgg 209 |||||||| |||||||||||| | ||||||||| |||| Sbjct: 7770145 aaaatttgtcgtgtcgagaccgggtaccgtatttttgg 7770108 Score = 46.1 bits (23), Expect = 0.001 Identities = 37/42 (88%) Strand = Plus / Minus Query: 170 acaaaatttgncgtgtcgagacctgttaccgtattgttggca 211 |||||| ||| |||||||||||| | ||||||||| |||||| Sbjct: 10925849 acaaaaattgtcgtgtcgagaccgggtaccgtatttttggca 10925808 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||| | ||||||||| Sbjct: 8985303 aaaatttgtcgtgtcgagaccgggtaccgtatt 8985335 Score = 42.1 bits (21), Expect = 0.019 Identities = 30/33 (90%) Strand = Plus / Plus Query: 181 cgtgtcgagacctgttaccgtattgttggcaaa 213 |||||||||||| | ||||||||| |||||||| Sbjct: 13275628 cgtgtcgagaccgggtaccgtatttttggcaaa 13275660 Score = 40.1 bits (20), Expect = 0.075 Identities = 31/35 (88%) Strand = Plus / Plus Query: 170 acaaaatttgncgtgtcgagacctgttaccgtatt 204 |||||| ||| |||||||||||| | ||||||||| Sbjct: 3003854 acaaaaattgtcgtgtcgagaccaggtaccgtatt 3003888 Score = 40.1 bits (20), Expect = 0.075 Identities = 23/24 (95%) Strand = Plus / Plus Query: 181 cgtgtcgagacctgttaccgtatt 204 |||||||||||||| ||||||||| Sbjct: 4449353 cgtgtcgagacctgctaccgtatt 4449376 Score = 40.1 bits (20), Expect = 0.075 Identities = 23/24 (95%) Strand = Plus / Minus Query: 181 cgtgtcgagacctgttaccgtatt 204 |||||||||||||| ||||||||| Sbjct: 7101745 cgtgtcgagacctggtaccgtatt 7101722 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgta 202 |||||||| |||||||||||| | ||||||| Sbjct: 7757929 aaaatttgccgtgtcgagaccgggtaccgta 7757959 Score = 40.1 bits (20), Expect = 0.075 Identities = 31/35 (88%) Strand = Plus / Minus Query: 170 acaaaatttgncgtgtcgagacctgttaccgtatt 204 ||||| |||| |||||||||||||| |||| |||| Sbjct: 12804687 acaaattttgtcgtgtcgagacctggtaccctatt 12804653 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgta 202 |||||||| |||||||||||| | ||||||| Sbjct: 13200985 aaaatttgtcgtgtcgagaccaggtaccgta 13200955 Score = 40.1 bits (20), Expect = 0.075 Identities = 22/23 (95%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctg 194 |||||||| |||||||||||||| Sbjct: 13371898 aaaatttgtcgtgtcgagacctg 13371920 Score = 38.2 bits (19), Expect = 0.30 Identities = 27/30 (90%) Strand = Plus / Plus Query: 175 atttgncgtgtcgagacctgttaccgtatt 204 ||||| |||||||||||| | ||||||||| Sbjct: 12332489 atttgtcgtgtcgagaccgggtaccgtatt 12332518 >I Length = 15072421 [Genome View]Score = 46.1 bits (23), Expect = 0.001 Identities = 37/42 (88%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggcaaa 213 ||||| || |||||||||||||| ||||||||| || ||||| Sbjct: 5863567 aaaatctgtcgtgtcgagacctggtaccgtattttttgcaaa 5863608 Score = 44.1 bits (22), Expect = 0.005 Identities = 28/30 (93%) Strand = Plus / Plus Query: 181 cgtgtcgagacctgttaccgtattgttggc 210 |||||||||||| ||||||||||| ||||| Sbjct: 2454336 cgtgtcgagaccggttaccgtatttttggc 2454365 Score = 44.1 bits (22), Expect = 0.005 Identities = 27/29 (93%) Strand = Plus / Plus Query: 176 tttgncgtgtcgagacctgttaccgtatt 204 |||| |||||||||||||| ||||||||| Sbjct: 3538208 tttgtcgtgtcgagacctggtaccgtatt 3538236 Score = 44.1 bits (22), Expect = 0.005 Identities = 30/33 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtatt 204 |||||||| |||||||||||| | ||||||||| Sbjct: 3860996 aaaatttgtcgtgtcgagaccgggtaccgtatt 3860964 Score = 42.1 bits (21), Expect = 0.019 Identities = 32/36 (88%) Strand = Plus / Plus Query: 171 caaaatttgncgtgtcgagacctgttaccgtattgt 206 ||||| ||| ||||||||| |||| ||||||||||| Sbjct: 213313 caaaaattgtcgtgtcgaggcctggtaccgtattgt 213348 Score = 42.1 bits (21), Expect = 0.019 Identities = 29/32 (90%) Strand = Plus / Plus Query: 173 aaatttgncgtgtcgagacctgttaccgtatt 204 ||||||| |||||||||||| | ||||||||| Sbjct: 2067949 aaatttgtcgtgtcgagaccggataccgtatt 2067980 Score = 42.1 bits (21), Expect = 0.019 Identities = 26/28 (92%) Strand = Plus / Minus Query: 177 ttgncgtgtcgagacctgttaccgtatt 204 ||| |||||||||||| ||||||||||| Sbjct: 2733742 ttgtcgtgtcgagaccagttaccgtatt 2733715 Score = 42.1 bits (21), Expect = 0.019 Identities = 26/28 (92%) Strand = Plus / Plus Query: 177 ttgncgtgtcgagacctgttaccgtatt 204 ||| |||||||||||| ||||||||||| Sbjct: 2734721 ttgtcgtgtcgagaccagttaccgtatt 2734748 Score = 42.1 bits (21), Expect = 0.019 Identities = 35/40 (87%) Strand = Plus / Plus Query: 171 caaaatttgncgtgtcgagacctgttaccgtattgttggc 210 ||||| ||| |||||||||||| | ||||||||| ||||| Sbjct: 3522964 caaaaattgtcgtgtcgagacccggtaccgtatttttggc 3523003 Score = 42.1 bits (21), Expect = 0.019 Identities = 26/28 (92%) Strand = Plus / Plus Query: 177 ttgncgtgtcgagacctgttaccgtatt 204 ||| |||||||||||||| ||||||||| Sbjct: 3606269 ttgtcgtgtcgagacctggtaccgtatt 3606296 Score = 42.1 bits (21), Expect = 0.019 Identities = 29/32 (90%) Strand = Plus / Plus Query: 171 caaaatttgncgtgtcgagacctgttaccgta 202 ||||| ||| |||||||||||||| ||||||| Sbjct: 4773631 caaaacttgtcgtgtcgagacctggtaccgta 4773662 Score = 42.1 bits (21), Expect = 0.019 Identities = 29/32 (90%) Strand = Plus / Plus Query: 173 aaatttgncgtgtcgagacctgttaccgtatt 204 ||||||| |||||||||||| | ||||||||| Sbjct: 5359662 aaatttgtcgtgtcgagaccgggtaccgtatt 5359693 Score = 42.1 bits (21), Expect = 0.019 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 gtcgagacctgttaccgtatt 204 ||||||||||||||||||||| Sbjct: 9774635 gtcgagacctgttaccgtatt 9774615 Score = 42.1 bits (21), Expect = 0.019 Identities = 27/29 (93%) Strand = Plus / Plus Query: 181 cgtgtcgagacctgttaccgtattgttgg 209 |||||||||||||| ||||||||| |||| Sbjct: 9964365 cgtgtcgagacctggtaccgtatttttgg 9964393 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgta 202 |||||||| |||||||||||| | ||||||| Sbjct: 1345601 aaaatttgtcgtgtcgagaccggataccgta 1345571 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgta 202 |||| ||| |||||||||||||| ||||||| Sbjct: 2289067 aaaaattgtcgtgtcgagacctggtaccgta 2289097 Score = 40.1 bits (20), Expect = 0.075 Identities = 31/35 (88%) Strand = Plus / Minus Query: 170 acaaaatttgncgtgtcgagacctgttaccgtatt 204 |||||| ||| |||||||||||| | ||||||||| Sbjct: 2491328 acaaaaattgtcgtgtcgagaccggataccgtatt 2491294 Score = 40.1 bits (20), Expect = 0.075 Identities = 23/24 (95%) Strand = Plus / Plus Query: 181 cgtgtcgagacctgttaccgtatt 204 |||||||||||| ||||||||||| Sbjct: 3688308 cgtgtcgagaccagttaccgtatt 3688331 Score = 40.1 bits (20), Expect = 0.075 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 gtcgagacctgttaccgtat 203 |||||||||||||||||||| Sbjct: 4578287 gtcgagacctgttaccgtat 4578268 Score = 40.1 bits (20), Expect = 0.075 Identities = 31/35 (88%) Strand = Plus / Plus Query: 177 ttgncgtgtcgagacctgttaccgtattgttggca 211 ||| |||||||||||| | ||||||||| |||||| Sbjct: 6787804 ttgtcgtgtcgagaccaggtaccgtatttttggca 6787838 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgta 202 |||| ||| ||||||||||||| |||||||| Sbjct: 9136452 aaaacttgtcgtgtcgagacctcttaccgta 9136422 Score = 40.1 bits (20), Expect = 0.075 Identities = 23/24 (95%) Strand = Plus / Plus Query: 181 cgtgtcgagacctgttaccgtatt 204 |||||||||||| ||||||||||| Sbjct: 9639437 cgtgtcgagaccggttaccgtatt 9639460 Score = 40.1 bits (20), Expect = 0.075 Identities = 23/24 (95%) Strand = Plus / Minus Query: 181 cgtgtcgagacctgttaccgtatt 204 |||||||||||| ||||||||||| Sbjct: 10237918 cgtgtcgagaccggttaccgtatt 10237895 Score = 40.1 bits (20), Expect = 0.075 Identities = 31/35 (88%) Strand = Plus / Minus Query: 170 acaaaatttgncgtgtcgagacctgttaccgtatt 204 |||||| ||| |||||||||||| | ||||||||| Sbjct: 10521218 acaaaaattgtcgtgtcgagaccggctaccgtatt 10521184 Score = 40.1 bits (20), Expect = 0.075 Identities = 34/39 (87%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgtattgttggc 210 |||| ||| |||||||||||| | ||||||||| ||||| Sbjct: 10805870 aaaaattgtcgtgtcgagaccgggtaccgtatttttggc 10805832 Score = 40.1 bits (20), Expect = 0.075 Identities = 22/23 (95%) Strand = Plus / Minus Query: 177 ttgncgtgtcgagacctgttacc 199 ||| ||||||||||||||||||| Sbjct: 12880905 ttgtcgtgtcgagacctgttacc 12880883 Score = 40.1 bits (20), Expect = 0.075 Identities = 28/31 (90%) Strand = Plus / Minus Query: 172 aaaatttgncgtgtcgagacctgttaccgta 202 |||||||| |||||||||||| | ||||||| Sbjct: 14762888 aaaatttgtcgtgtcgagaccgggtaccgta 14762858 Score = 38.2 bits (19), Expect = 0.30 Identities = 21/22 (95%) Strand = Plus / Minus Query: 171 caaaatttgncgtgtcgagacc 192 ||||||||| |||||||||||| Sbjct: 3599138 caaaatttgtcgtgtcgagacc 3599117 Score = 38.2 bits (19), Expect = 0.30 Identities = 24/26 (92%) Strand = Plus / Plus Query: 177 ttgncgtgtcgagacctgttaccgta 202 ||| |||||||||||||| ||||||| Sbjct: 4194326 ttgtcgtgtcgagacctggtaccgta 4194351 Score = 38.2 bits (19), Expect = 0.30 Identities = 30/34 (88%) Strand = Plus / Minus Query: 177 ttgncgtgtcgagacctgttaccgtattgttggc 210 ||| |||||||||||| | ||||||||| ||||| Sbjct: 7312332 ttgtcgtgtcgagaccgggtaccgtatttttggc 7312299 Score = 38.2 bits (19), Expect = 0.30 Identities = 22/23 (95%) Strand = Plus / Minus Query: 181 cgtgtcgagacctgttaccgtat 203 |||||||||||||| |||||||| Sbjct: 7966122 cgtgtcgagacctgataccgtat 7966100 Score = 38.2 bits (19), Expect = 0.30 Identities = 27/30 (90%) Strand = Plus / Plus Query: 175 atttgncgtgtcgagacctgttaccgtatt 204 ||||| |||||||||||| | ||||||||| Sbjct: 10521389 atttgtcgtgtcgagaccaggtaccgtatt 10521418 Score = 38.2 bits (19), Expect = 0.30 Identities = 27/30 (90%) Strand = Plus / Plus Query: 172 aaaatttgncgtgtcgagacctgttaccgt 201 |||| ||| |||||||||||||| |||||| Sbjct: 12881092 aaaagttgtcgtgtcgagacctggtaccgt 12881121 |
|
