Home | Genome | Blast / Blat | WormMart | Batch Sequences | Markers | Genetic Maps | Submit | Searches | Site Map |
BLAST/BLAT RESULTS |
||
|
BLASTN 2.2.17 [Aug-26-2007]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= F01_C21F1_11.ab1 ABIX Testing -- no comment (854 letters) Database: c_elegans nucleotide release [WS195] 7 sequences; 100,281,427 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value III 186 5e-46 [Alignment][Genome View] V 40 0.069 [Alignment][Genome View] IV 38 0.27 [Alignment][Genome View] >III Length = 13783681 [Genome View] Score = 186 bits (94), Expect = 5e-46 Identities = 94/94 (100%) Strand = Plus / Minus Query: 35 ttcgtccaccgctctccacttatagtacgaatctttatttcatttattgaaatgttgtcg 94 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9910649 ttcgtccaccgctctccacttatagtacgaatctttatttcatttattgaaatgttgtcg 9910590 Query: 95 ttcgtcaaacgttctaaacaacccgcatatttca 128 |||||||||||||||||||||||||||||||||| Sbjct: 9910589 ttcgtcaaacgttctaaacaacccgcatatttca 9910556 >V Length = 20919569 [Genome View] Score = 40.1 bits (20), Expect = 0.069 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 ttatttcatttattgaaatg 88 |||||||||||||||||||| Sbjct: 13983632 ttatttcatttattgaaatg 13983651 >IV Length = 17493784 [Genome View] Score = 38.2 bits (19), Expect = 0.27 Identities = 19/19 (100%) Strand = Plus / Plus Query: 68 tttatttcatttattgaaa 86 ||||||||||||||||||| Sbjct: 5637786 tttatttcatttattgaaa 5637804 |
|